RT-PCR of Undifferentiated Cells
BG01(1), UC06, WA01, WA07, and WA09 have been tested and found to express Oct-4 and Nanog mRNA in the undifferentiated state. With these Nanog primers, several bands may be observed in different cell lines. As they are located in the 3'UTR, we believe these to be most likely due to a polymorphism.

1 = WA01, 7 = WA07, M = MEF, - = H20 negative control
RT-PCR Protocol
- hESC colonies are collected and washed by sedimentation and RNA extracted by standard protocols (Trizol etc).
- Up to 5μg total RNA is used to make cDNA using the Superscript III system (Invitrogen Cat #18080-044). This is sufficient for 20 PCR reactions.
- PCR Mix
| cDNA |
1μl |
| 10x PCR Buffer |
2.5μl |
| 50mM MgCl2 |
0.75μl |
| 10mM dNTPs |
0.5μl |
| 20μM Forward primer |
0.5μl |
| 20μM Reverse Primer |
0.5μl |
| H2O |
19μl |
| 5 Units/μl Taq Polymerase |
0.25μl |
- Reactions are subjected to 30 PCR cycles after denaturation (4 mins 94°C) as follows: 94°C for 30s; annealing temp for 30s; 72°C for 30s
- Products are separated on a 2% agarose gel
| Gene |
Forward Primer |
Reverse Primer
| Prod. Size |
Anneal. Temp |
| Oct-4 |
cttgctgcagaagtgggtggaggaa |
ctgcagtgtgggtttcgggca |
169bp |
55°C |
| Nanog |
gcgcggtcttggctcactgc |
gcctcccaatcccaaacaatacga |
426bp |
59°C |
| β-actin |
cgcaccactggcattgtcat |
ttctccttgatgtcacgcac |
200bp |
55°C |